Ture was heated at 65uC for 5 min and quick-chilled on ice. The contents of the tube were collected by centrifugation and 2 mL of DTT (0.1 M), 4 mL of 56 firststrand buffer, 1 mL of RNase inhibitor (40 U/mL, Qiagen) were added. The mixture was incubated at 37uC for 2 min, followed by the addition of 1 mL of M-MLV (200 U) and the incubation was continued for 50 min at 37uC. The reaction was inactivated by heating at 70uC for 15 min. The RT reaction was performed in triplicate to remove the RT outliers.Materials and Methods Primers and Synthetic MicroRNA MoleculesThe sequences of the 11 microRNA molecules selected for this assay were obtained from the miRBase Sequence Database Release 15 (www.mirbase.org). Synthetic miRNA molecules used for the validation of the method were purchased from Genepharma (Shanghai, China). Gene-specific primers were designed according to the miRBase Sequence Database and synthesized byFacile and Specific Assay for Quantifying MicroRNATable 18334597 2. Oligonucleotides used in this study.Name hsa-miR-455 hsa-miR-126 hsa-miR-32 hsa-miR-181a hsa-miR-181b hsa-let-7a hsa-let-7b hsa-let-7c hsa-let-7d hsa-let-7e mmu-miR-122 mmu-miR-133a mmu-let-7a cel-miR-2 real-time PCR primers miR-455-fw miR-126-fw miR-32-fw miR-181a-fw miR-181b-fw let-7a-fw1 let-7b-fw let-7c-fw let-7d-fw let-7e-fw mmu-miR122-fw mmu-miR-133a-fw miR-2-fw U6-Fw miRNA-rev Reverser transcription primer MedChemExpress Nafarelin Linear RT SL-poly(A)Sequence (59 to 39) GCAGUCCAUGGGCAUAUACAC UCGUACCGUGAGUAAUAAUGCG UAUUGCACAUUACUAAGUUGCA AACAUUCAACGCUGUCGGUGAGU AACAUUCAUUGCUGUCGGUGGGU UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU Pentagastrin AGAGGUAGUAGGUUGCAUAGUU UGAGGUAGGAGGUUGUAUAGUU UGGAGUGUGACAAUGGUGUUUG GCUGGUAAAAUGGAACCAAAU UGAGGUAGUAGGUUGUAUAGUU UAUCACAGCCAGCUUUGAUGUGCGAACTGCAGTCCATGGGCATA AGACCTCGTACCGTGAGTAATA GCAAGTATTGCACATTACTAAG ACTGAAACATTCAACGCTGTCGG TGACGAACATTCATTGCTGTCGG CGTCTGAGGTAGTAGGTTGTATA GTCGTGAGGTAGTAGGTTGTGTG GTCGTGAGGTAGTAGGTTGTATGGT TGACTAGAGGTAGTAGGTTGCATA ATGTCTGAGGTAGGAGGTTGTATA TGTCATGGAGTGTGACAATGGTG ATTCAGCTGGTAAAATGGAACC GCTAGTATCACAGCCAGCTTTGA CTCGCTTCGGCAGCACA GCAGGGTCCGAGGTATTCGCGAGCACAGAATTAATACGACTCACTATAGGACGGCTTTTTTTTTTTTTTTVN GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVNStem-loop sequence is indicated in italic. Binding sequences for universal reverse primer are indicated in italic and bold. miRNA specific sequences of the forward primer are in bold. 1 hsa-let-7a and mmu-let-7a are highly conservative. They share the same forward primer. 2 V: A, C and G; N: A, C, G and T. doi:10.1371/journal.pone.0046890.tQuantitative Real-time PCRReal-time PCR was performed using the standard SYBRH Green PCR protocol (SYBRH Green Real-time PCR Master Mix, Toyobo, catalogue no. QPK-201) on a Rotor-Gene RG-3000A thermal cycler (Corbett Research), and each sample was analyzed in
triplicate. The 20 mL PCR volume included 3 mL of RT product,
10 mL of 1326631 26 SYBRH Green real-time PCR Master Mix, and 1 mL of primer (forward and reverse, 5 mM each). The reactions were incubated at 95uC for 5 min, followed by 45 cycles of 95uC for 15 s, 55uC for 15 s, and 72uC for 20 s. The level of miRNA expression was measured using the Cq (quantification cycle) value. Cq is the fractional cycle number at which the fluorescence of each sample passes a fixed threshold. A synthetic miRNA molecule was used for calculation of the standard curve.The 22DDCq method for relative quantification of gene expression was used to determine the level of miRNA expression. DCq.Ture was heated at 65uC for 5 min and quick-chilled on ice. The contents of the tube were collected by centrifugation and 2 mL of DTT (0.1 M), 4 mL of 56 firststrand buffer, 1 mL of RNase inhibitor (40 U/mL, Qiagen) were added. The mixture was incubated at 37uC for 2 min, followed by the addition of 1 mL of M-MLV (200 U) and the incubation was continued for 50 min at 37uC. The reaction was inactivated by heating at 70uC for 15 min. The RT reaction was performed in triplicate to remove the RT outliers.Materials and Methods Primers and Synthetic MicroRNA MoleculesThe sequences of the 11 microRNA molecules selected for this assay were obtained from the miRBase Sequence Database Release 15 (www.mirbase.org). Synthetic miRNA molecules used for the validation of the method were purchased from Genepharma (Shanghai, China). Gene-specific primers were designed according to the miRBase Sequence Database and synthesized byFacile and Specific Assay for Quantifying MicroRNATable 18334597 2. Oligonucleotides used in this study.Name hsa-miR-455 hsa-miR-126 hsa-miR-32 hsa-miR-181a hsa-miR-181b hsa-let-7a hsa-let-7b hsa-let-7c hsa-let-7d hsa-let-7e mmu-miR-122 mmu-miR-133a mmu-let-7a cel-miR-2 real-time PCR primers miR-455-fw miR-126-fw miR-32-fw miR-181a-fw miR-181b-fw let-7a-fw1 let-7b-fw let-7c-fw let-7d-fw let-7e-fw mmu-miR122-fw mmu-miR-133a-fw miR-2-fw U6-Fw miRNA-rev Reverser transcription primer Linear RT SL-poly(A)Sequence (59 to 39) GCAGUCCAUGGGCAUAUACAC UCGUACCGUGAGUAAUAAUGCG UAUUGCACAUUACUAAGUUGCA AACAUUCAACGCUGUCGGUGAGU AACAUUCAUUGCUGUCGGUGGGU UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGUU UGAGGUAGGAGGUUGUAUAGUU UGGAGUGUGACAAUGGUGUUUG GCUGGUAAAAUGGAACCAAAU UGAGGUAGUAGGUUGUAUAGUU UAUCACAGCCAGCUUUGAUGUGCGAACTGCAGTCCATGGGCATA AGACCTCGTACCGTGAGTAATA GCAAGTATTGCACATTACTAAG ACTGAAACATTCAACGCTGTCGG TGACGAACATTCATTGCTGTCGG CGTCTGAGGTAGTAGGTTGTATA GTCGTGAGGTAGTAGGTTGTGTG GTCGTGAGGTAGTAGGTTGTATGGT TGACTAGAGGTAGTAGGTTGCATA ATGTCTGAGGTAGGAGGTTGTATA TGTCATGGAGTGTGACAATGGTG ATTCAGCTGGTAAAATGGAACC GCTAGTATCACAGCCAGCTTTGA CTCGCTTCGGCAGCACA GCAGGGTCCGAGGTATTCGCGAGCACAGAATTAATACGACTCACTATAGGACGGCTTTTTTTTTTTTTTTVN GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVNStem-loop sequence is indicated in italic. Binding sequences for universal reverse primer are indicated in italic and bold. miRNA specific sequences of the forward primer are in bold. 1 hsa-let-7a and mmu-let-7a are highly conservative. They share the same forward primer. 2 V: A, C and G; N: A, C, G and T. doi:10.1371/journal.pone.0046890.tQuantitative Real-time PCRReal-time PCR was performed using the standard SYBRH Green PCR protocol (SYBRH Green Real-time PCR Master Mix, Toyobo, catalogue no. QPK-201) on a Rotor-Gene RG-3000A thermal cycler (Corbett Research), and each sample was analyzed in triplicate. The 20 mL PCR volume included 3 mL of RT product, 10 mL of 1326631 26 SYBRH Green real-time PCR Master Mix, and 1 mL of primer (forward and reverse, 5 mM each). The reactions were incubated at 95uC for 5 min, followed by 45 cycles of 95uC for 15 s, 55uC for 15 s, and 72uC for 20 s. The level of miRNA expression was measured using the Cq (quantification cycle) value. Cq is the fractional cycle number at which the fluorescence of each sample passes a fixed threshold. A synthetic miRNA molecule was used for calculation of the standard curve.The 22DDCq method for relative quantification of gene expression was used to determine the level of miRNA expression. DCq.
Posted inUncategorized